脂肪酶抑制剂

Martin et al. Lipids in Health and Disease 2013, 12:48http://www.lipidworld.com/content/12/1/48

PPAR γas a sensor of lipase activity and a target for the

Harry Martin *

, Tony K McGhie, Kerry Bentley-Hewitt and John Christeller

Background

The PPAR γagonist and anti-diabetic drug Rosiglitazone is known to induce expression of the human β-defensin 1(hBD1)gene in human intestinal epithelial Caco-2cells [1].Defensins are cationic peptides expressed in phago-cytic and epithelial cells that lyse micro-organisms by forming pores in their membranes. Deficiency of defensin expression is associated with colonisation of the gut with Candida albicans [2]and also with Crohn ’s disease [3].Rosiglitazone has been used in the treatment of ulcerative colitis [4]but it has been associated with adverse cardio-vascular effects in the treatment of type 2diabetes [5].The lipase inhibiting drug Orlistat is marketed by Roche under the trade name Xenical. It has a worldwide distribu-tion and is used as an oral treatment for obesity [6].Orlistat is also known as tetrahydrolipstatin and is a modi-fied form of the streptomyces-derived lipase inhibitor lipstatin [7].Orlistat is very hydrophobic:(logP7.6-8.1)

*Correspondence:[email protected]

Food Innovation, the New Zealand Institute for Plant &Food Research Ltd, Private Bag 11600, Palmerston North 4442, New Zealand

in the gut lumen [9].However, Orlistat penetrates cell membranes sufficiently to have intracellular effects [10,11].Liposarcoma cell growth is inhibited at a concentration of 20μM via inhibition of the intracellular enzyme, fatty acid synthase [12].For this reason, Orlistat ’s anti-cancer proper-ties are being explored in a number of cancerous tissues including colorectal [13],prostate [14]and leukemic cells [15].The extreme hydrophobicity of Orlistat led us to speculate that it might also behave as a PPAR γagonist in the gut epithelium where, due to its retention in the gut lumen, the local Orlistat concentration is high.

PPAR γbinding activity was assayed by fluorescence polarization (FP)and mass spectrometry. Steady state mRNA levels of some PPAR γregulated genes in human Caco-2epithelial cells were determined, including beta defensin-1, (hBD1),adipose differentiation related pro-tein (ADRP)and PPAR γitself. In addition, due to the ability of PPAR γto bind a wide variety of fatty acids [16]

2013Martin et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Martin et al. Lipids in Health and Disease 2013, 12:48http://www.lipidworld.com/content/12/1/48

Page 2of 8

we explored the utility of the PPAR γFP assay as a real-time assay for lipase activity.

Results

Real time lipase assay using PPAR γfluorescence polarization method

Candida rugosa lipase and porcine pancreatic lipase were incubated at concentrations ranging from 30μg/mLto 3.3μg/mLwith various triglyceride emulsions in the pre-sence of the FP reagents and polarization readings were taken at 1–2minute intervals for up to 30minutes. The PPAR γbinding products released from the triglyceride emulsions were detected by the FP assay. Figure 1A shows the release of PPAR γbinding products from digestion of varying concentrations of grape seed oil emulsion with Candida rugosa lipase. Figure 1B shows the release of PPAR γbinding products from triolein using different con-centrations of porcine pancreatic lipase. Figure 1C shows that release of PPAR γbinding ligands during the digestion of emulsions of three different substrates viz. grape seed oil, triolein, and olive oil. To confirm the utility of the FP assay as a lipase assay, the initial velocities (Vo ) of the en-zyme rates (fromFigure 1A) at the three different

concentrations were estimated and shown to be linear over a 9-fold dilution range (Figures1D and 1E). These experiments have been repeated at least three times and the results shown are representative of the assay data which are highly reproducible. Because the FP assay is car-ried out in a 20μl volume in a 384well microplate, run-ning replicates is simple and inexpensive.

Measurement of Orlistat binding to PPAR γby Fluorescence Polarization

Although lipase activity is readily traced by the release of fatty acids from the triglyceride substrate, the use of PPAR γFP assay as a lipase assay has the limitation that lipase inhibitors will tend to bind directly to the PPAR γdue to their hydrophobic nature. Figure 2shows that Orlistat is a PPAR γligand with an IC 50of 2.84μM, ±0.16.By comparison, the PPAR γagonists Troglitazone and Rosiglitazone are shown with IC 50values of 1.27μM ±0.08and 0.37μM ±0.04respectively.

Orlistat does not modify PPAR γcovalently

Orlistat (Figure2) forms a covalent adduct with pancreatic lipase and contains 3carbonyl groups. Several carbonyl

Martin et al. Lipids in Health and Disease 2013, 12:48http://www.lipidworld.com/content/12/1/48

Page 3of 8

containing fatty acids are known to bind covalently to the Cys285in the ligand binding pocket of PPAR γ[17].For this reason we investigated the possibility of covalent modification of PPAR γby Orlistat by mass spectrometry. Orlistat was incubated in ammonium acetate buffer pH 7.4with PPAR γfor 1hour at room temperature and then analysed by LCMS. The sulfhydryl-specific reagent iodo-acetamido fluorescein (IAF)was included to confirm that this procedure was able to detect covalent modifica-tion of the PPAR γ. The molecular weight of the PPAR γwas confirmed at 35,918Da and is consistent with data provided by the supplier. When IAF is added the molecu-lar weight of PPAR γincreased to 36,308Da, an increase of 390Da, consistent with the addition of IAF to a sulfhydryl group on the PPAR γmolecule. However, the molecular weight of PPAR γremained at 35,319Da when Orlistat was added, suggesting that Orlistat does not form covalent bonds with PPAR γ(Figure3). In addition, two covalent PPAR γligands, Dithio-bis (2-nitrobenzoicacid) and GW9662, were also confirmed bind to PPAR γirreversibly (datanot shown).

Orlistat induces hBD1, ADRP &PPAR γmRNA expression in Caco-2cells

100, 10and 1μM. The results of both experiments are shown in Figure 4. In the first experiment gene transcrip-tion of hBD1, PPAR γ, ADRP and were all significantly en-hanced by treatment with 100μM Orlistat by 3.0, 6.0and 5.7fold respectively and also by Rosiglitazone, the positive control. In the second experiment, significant increases in defensin gene transcription occurred at all three concen-trations of Orlistat. Even at 1μM Orlistat a 1.4fold increase in defensin transcription was observed. In the second experiment, ADRP gene transcription was increased by around seven fold using Orlistat at 100μM and 10μM but no increase was observed at 1uM Orlistat. For reasons unknown, the PPAR γgene induction seen in the first experiment was not observed in the second experiment.

Orlistat induces hBD1protein expression in expression in HT-29cells

Treatment of Caco-2human intestinal epithelial cells with the PPAR γactivator Rosiglitazone is known to in-duce the induction and expression of the hBD1gene and Adipose Differentiation Related Protein (ADRP).To determine whether Orlistat is also a PPAR γactivator we treated Caco-2cells with 100μM Orlistat or with 1μM Rosiglitazone for 24hours before cells were harvested for analysis of gene induction. Following the initial ob-servation that 100μM Orlistat induced hBD1gene ex-pression, the experiment was repeated using Orlistat at

To establish whether the Orlistat and Rosiglitazone in-duced βdefensin1mRNA expression was also associated with an increase in βdefensin1protein synthesis, we first performed a sandwich ELISA on the tissue culture super-natants of Caco2cells treated with Orlistat. We were unable to detect βdefensin1protein in the Caco2super-natants although Caco2are reported to synthesis βdefensin1[18].The related cell line HT-29(ahuman co-lonic adenocarcinoma) was then used as an alternative to Caco2(alsohuman colorectal adenocarcinoma). Orlistat &Rosiglitazone we tested at concentrations of 1, 10and 100μM for 24h in culture. The supernatant was analysed by sandwich ELISA for hBD1protein and the results are shown in Figure 5. Although the average defensin protein was increased at all concentrations of drug treatment, sig-nificant increases in defensin levels were only found at

Martin et al. Lipids in Health and Disease 2013, 12:48http://www.lipidworld.com/content/12/1/48

Page 4of 8

Martin et al. Lipids in Health and Disease 2013, 12:48http://www.lipidworld.com/content/12/1/48

Page 5of 8

10μM Orlistat (~1.5fold increase) &10μM Rosiglitazone (~2fold increase).

Discussion

The PPAR γFP assay provides a homogeneous and high-throughput method (Figure1) for continuous monitor-ing of lipase reaction kinetics. The sensitivity of the assay is determined by the affinity of the fatty acid pro-duct for PPAR γligand binding domain, which for many

PPAR γligands is in the low micromolar range. Since PPAR γis a non-selective binder of various fatty acids, the assay is will not distinguish different lipase products. The overlapping curves in Figure 1C may therefore re-flect the formation of different products with different affinities for PPAR γ. Triolein yields oleic acid as a lipase digestion product whereas around 70%of the fatty acid content of grape seed oil is linoleic acid. The wide range of fatty acids which are PPAR γligands means that the assay can be applied to the analyses of many lipases &sub-strates. At high concentrations of substrate (Figure1A, 1E), the rate of product formation is directly correlated with lipase concentration whereas at low substrate con-centrations (Figure1B, 1C) a distinct lag period is evident before product formation becomes detectable, giving the reaction curve a sigmoidal appearance. The reasons for the lag period are unclear at present and may reflect a combination of causes; the use of substrate at concen-trations lower than the lipase K m ; partitioning of the emulsion substrate and enzyme at low substrate concen-trations; a low threshold of product formation may be re-quired before the fluorescent ligand can be displaced from the PPAR γreceptor in the FP reaction. Nonetheless, as Figure 1A shows, the FP assay is extremely simple and sensitive as a method detecting and for quantifying lipase in a sample. FP , as a ratiometric technique, is less sensitive to sample colour and opacity than direct fluorescence intensity methods. However, as the Orlistat data shows (Figure2) the PPAR γFP procedure is unlikely to permit the analysis of lipase inhibitors since their lipophilicity will tend to make them PPAR γligands. It is well known that cytosolic phospholipases initiate signal transduction path-ways by releasing fatty acid signalling molecules from phospholipid membranes and that many of the phospho-lipase products are PPAR ligands. Thus, the in vitro gener-ation of PPAR γligands from lipase activity shown in Figure 1is analogous to the situation in cells whereby

phospholipase A 2activation results in the generation of PPAR δligands and the subsequent expression of PPAR δdependent genes [19].

The possibility of covalent bond formation between Orlistat &PPAR γwas investigated because Orlistat binds covalently to pancreatic and other lipases [8]and because keto-fatty acids are known to form a covalent bond with Cys285in the ligand binding pocket of PPAR γ[17].The mass spectrometry data shown in Figure 3clearly demon-strated that Orlistat, which contains 3carbonyls [7],does not bind covalently to PPAR γsince no adduct was detect-able by mass spectrometry.

The induction of beta defensin-1, and ADRP by Orlistat (Figure4) in Caco-2cells along with the direct binding of Orlistat to PPAR γ(Figure2), is strong evi-dence that Orlistat is a PPAR γagonist since these genes are known to be induced by the PPAR γagonist drugs Troglitazone and Rosiglitazone [1,20].In Figure 4, Orlistat was used at a concentration as high as 100μM because this concentration in the gut lumen would be achieved by the standard daily dose of 0.36g Orlistat [21]coupled with almost complete retention of the drug in the in the gastrointestinal tract [9].Although Orlistat will induce cell death in human colonic adenocarcinoma HT29cells at a concentration of 100μM over 48hours it does not induce cell death at 200μM over a period of 24hours [13]and it is far less toxic to normal cells than to cancerous cells [14,15].Furthermore, we see no evi-dence of cell death in our Caco-2culture, for example, by detecting lower levels of control GAPDH RNA. Al-though Rosiglitazone was slightly toxic to HT-29cells at 100μM (Figure5) no evidence of toxicity was observed at 10μM at which a two-fold increase in β-defensin 1protein was observed. Peyrin-Biroulet et al. (2010)has shown that Rosiglitazone induced hBD1mRNA. Our data now confirms that hBD1protein is also induced by Rosiglitazone. Although the Orlistat induced defensin protein is only increased by 1.5fold at 10μM, this may result in a significant physiological effect in patients in terms of pathogen resistance. A future study of the fae-cal hBD1protein content in Orlistat patients might con-firm a PPAR γmediated physiological benefit of Orlistat. Orlistat suppresses the onset of type 2diabetes [22]due the reduced calorific intake, and concomitant weight loss of patients. As a consequence of Orlistat ’s PPAR γagonist activity, there may be local insulin sensitising effects in the gut epithelium and additional physiological responses in-cluding increased hBD1and PPAR γtranscription.

PPAR γactivation is enhanced by the actions of cyto-solic fatty acid binding proteins which deliver sparingly soluble fatty acid ligands to the nucleus [23].This raises the question of whether Orlistat also binds to intracellu-lar fatty acid binding proteins in gut epithelial cells and what the consequences of that putative binding might

be. Orlistat consumption is well known to cause steator-rhea due to the arrival of undigested fat in the colon. Al-though Orlistat is an irreversible inhibitor of pancreatic lipase, it is a reversible inhibitor of certain bacterial li-pases and not an inhibitor of a staphylococcal extracellular lipase [24].Some colonic digestion of fats is likely to occur through bacterially-derived lipases in patients using Orlistat. The fatty acids produced in these circum-stances may induce PPAR γdependent gene transcrip-tion in the epithelial cells of the intestine in the same way that Orlistat affects Caco-2cells. Thus, in addition to pro-apoptotic side effects of Orlistat in colorectal carcinoma cells [13],Orlistat may also induce anti-inflammatory genes in gut tissue mediated by its PPAR γagonist activity.

Conclusions

The widely used lipase inhibitor drug Orlistat binds revers-ibly to PPAR γwith an IC 50of 2.8μM. Orlistat acts on gut epithelial Caco-2cells as a PPAR γagonist and increases synthesis of human defensin β1and ADRP mRNA. Methods

Chemicals and materials

Rosiglitazone, Troglitazone, 5-amino salicylic acid, GW9662(acovalent binding PPAR γantagonist [25]),Orlistat, triolein and iodo-acetamido-fluorescein were supplied by Sigma-Aldrich. Grape seed oil and olive oil were commercial brands from local supermarkets in Palmerston North, New Zealand. LC-MS grade acetonitrile was from Thermo Scientific, methanol (ChromAR)was from Mallinckrodt Chemicals, and ethanol (95%)was from LabServ.

Fluorescence Polarization assay of PPAR γligands

FP assays were performed on the Tecan Safire2fluores-cence microplate reader (Tecan,Austria) at 22°C,in a volume of 20μL in Nunc 384well, black, shallow microplates. The PPAR γ(green)competitive binding assay (PolarScreen) kit was supplied by Invitrogen

Table 1qPCR oligonucleotides and RT-qPCR efficiencies for Caco-2cells

Gene name /(genebankaccession no.) Primer and probe sequences GAPDH:Glyceraldehyde-3-phosphate F:AGCCACATCGCTCAGACAC dehydrogenase (NM_002046.3)R:GCCCAATACGACCAAATCC ACTB, β-actin (NM_005345.4)

F:GGAGTCCTACGCCTTCAACA R:CCAGCACCTTCTTCTTGTCG

hBD1, Human βdefensin 1(X92744.1)

F:TGTCTGAGATGGCCTCAG GT R:GGGCAGGCAGAATAGAGACA

ADRP, Adipose Differentiation Related F:TCAGCTCCATTCTACTGTTCACC Protein (NM_001122.2)R:CCTGAATTTTCTGATTGGCACT PPAR γvariant 1(NM_138712.3)

F:GACAGGAAAGACAACAGAC AAATC

R:GGGGTGATGTGTTTGAACTTG

Corporation, Carlsbad, CA, USA. For measurement of FP , excitation and emission wavelengths were set at 470nm and 525nm. Sigmoidal and exponential curve fitting and IC 50and V o estimates were performed with Origin software (Origin-Lab,Northampton, MA, USA) using the logistic and MonoMolecular equations respect-ively . Data presented are representative of at least two independent experiments.

Lipase assays

Porcine pancreatic lipase (L3126)and Candida rugosa lip-ase (L1754)was supplied by Sigma. Triolein, grape seed oil &olive oil were used as triglyceride substrates for lipase assays. Lipase substrate was prepared according to the method of Nilsson-Ehle [26].Briefly, substrate emul-sions were prepared by mixing 240mg triglyceride sub-strate and 40mg whey protein (WP1485)in 10g glycerol. 200μL of this stock solution was added to 800μL 50mM Hepes buffer pH7.5which was sonicated for six periods of 5sec at 6watts for each mL of assay mix. For FP assays, the substrate emulsions were diluted in Invitrogen FP PPAR γassay buffer to a final concentration of 0.15mg/mLtriglyceride and digested with lipase for 30minutes at 22°Cin volumes of 20μL. During the digestion period, FP read-ings were taken at 1or 2minute intervals.

LC-QTOF-HRMS

The LC-MS system was composed of a Dionex Ultimate 3000Rapid Separation LC system and a micrOTOF QII mass spectrometer (BrukerDaltonics, Bremen, Germany) and was operating in positive mode with an electrospray ionization source. The LC system contained a SRD-3400solvent rack/degasser,HPR-3400RS binary pump, WPS-3000RS thermostated autosampler, and a TCC-3000RS thermostated column compartment. The analytical col-umn was a Zorbax SB-C182.1×100mm, 1.8μm (Agilent,Melbourne, Australia) maintained at 50°Cand operated in gradient mode. Solvents were A =0.5%formicacid, and B =100%acetonitrileat a flow of 400μL/min.The gradient was:70%A,30%B,0–0.5min; linear gradient to 45%A,55%B,0.5-25min; linear gradient to 2%A,98%B,25–45min; composition held at 2%A,98%B,45–50min; linear gradient to 70%A,30%B,50–50.2min; to return to the initial conditions before another sample injection at 54min. The injection volume for samples and standards was 2μL. The micrOTOF QII source parameters were:temperature 200°C;drying N2flow 8L/min;nebulizer N24.0bar, endplate offset -500V, capillary voltage −4000V; mass range 100–1500Da, acquired at 2scans/s.Post-acquisition internal mass calibration used sodium formate clusters with the sodium formate delivered by a syringe pump at the start of each chromatographic analysis.

Tissue culture

Caco-2cells and HT-29cells were cultured in DMEM supplemented with 5%Foetalbovine serum, glutamine &antibiotics at 37°C,5%CO2. Test compounds in DMSO were tested in triplicate by addition of 1μl of test com-pound to 1ml cell culture for 24h.

Real-Time RT-PCR

Total RNA was extracted by the use of High Pure RNA Isolation Kit and reverse transcription performed using Transcriptor First Strand cDNA Synthesis kit with oligo-dT primed reactions, both according to manufacturer ’s instructions (RocheDiagnostics, New Zealand). Primers and primer-dual hybridisation probe combinations (RocheDiagnostics, Germany-Table 1) were designed online using the Universal probe library system assay design centre (RocheApplied Science). The RT-qPCR assay was performed using the Lightcycler480system (RocheDiagnostics, Germany) with three reactions (technicalreplicates) for each sample. Real-time PCR parameters are as follows:10minutes (0:10:00)pre-incubation at 95°C,40cycles of amplification from 95°C(0:00:10),to 58°C(0:00:20),to 72°C(0:00:01),followed by cooling at 40°C(0:00:10).Results were relative to the expression of glyceraldehyde-3-phosphate dehydrogenase and β-actin, however the latter produced most consistent expression between samples and was used as the reference gene to calculate final relative expression.

Statistical analysis

Quantitative RT-PCR results were analysed using inbuilt relative quantification software (Light–Cycler 480soft-ware version 1.0), using the standard curve for both tar-get and reference (ACTB)gene and the software then determined the target to reference ratio.

β-defensin ELISA

24h tissue culture supernatants were analysed in triplicate for human-βdefensin 1using a commercial sandwich ELISA kit supplied by Genway, San Diego.

Competing interests

None of the authors have a financial conflict of interest in regards to the materials included in this paper.

Authors ’contributions

Orlistat, Lipases and triglyceride substrates were supplied &prepared by JC. Fluorescence Polarization assays were performed by HM. Mass spectrometry was carried out by TMcG. RT-PCR &defensin ELISAs were performed by KBH. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by Nutrigenomics New Zealand, a collaboration between AgResearch Ltd., Plant and Food Research, and The University of Auckland with funding through the New Zealand Ministry of Science and Innovation (MSI).

Harry Martin was funded by Nutrigenomics New Zealand.

Martin et al. Lipids in Health and Disease 2013, 12:48http://www.lipidworld.com/content/12/1/48

Received:6March 2013Accepted:31March 2013Published:8April 2013

References

1. Peyrin-Biroulet L, Beisner J, Wang GX, Nuding S, Oommen ST, Kelly D,

Parmentier-Decrucq E, Dessein R, Merour E, Chavatte P, et al :Peroxisome proliferator-activated receptor gamma activation is required for

maintenance of innate antimicrobial immunity in the colon. Proc Natl Acad Sci USA 2010, 107:8772–8777.

2. Jurevic RJ, Bai M, Chadwick RB, White TC, Dale BA:Single-nucleotide

Polymorphisms (SNPs)in human beta-defensin 1:High-throughput SNP assays and association with Candida carriage in type I diabetics and nondiabetic controls. J Clin Microbiol 2003, 41:90–96.

3. Kocsis AK, Lakatos PL, Somogyvari F, Fuszek P, Papp J, Fischer S, Szamosi T,

Lakatos L, Kovacs A, Hofner P, Mandi Y:Association of beta-defensin 1single nucleotide polymorphisms with Crohn's disease. Scand J Gastroenterol 2008, 43:299–307.

4. Lewis JD, Lichtenstein GR, Deren JJ, Sands BE, Hanauer SB, Katz JA, Lashner

B, Present DH, Chuai S, Ellenbergr JH, et al :Rosiglitazone for active

ulcerative colitis:A randomized placebo-controlled trial. Gastroenterology 2008, 134:688–695.

5. Nissen SE, Wolski K:Effect of Rosiglitazone on the risk of myocardial

infarction and death from cardiovascular causes. N Engl J Med 2007, 356:2457–2471.

6. Drent ML, Vanderveen EA:Lipase Inhibition -a Novel Concept in the

Treatment of Obesity. Int J Obes 1993, 17:241–244.

7. Barbier P, Schneider F:Syntheses of Tetrahydrolipstatin and Absolute-Configuration of Tetrahydrolipstatin and Lipstatin. Helvetica Chimica Acta 1987, 70:196–202.

8. Hadvary P, Sidler W, Meister W, Vetter W, Wolfer H:The Lipase Inhibitor

Tetrahydrolipstatin Binds Covalently to the Putative Active-Site Serine of Pancreatic Lipase. J Biol Chem 1991, 266:2021–2027.

9. Padwal RS, Majumdar SR:Drug treatments for obesity:Orlistat,

sibutramine, and rimonabant. Lancet 2007, 369:71–77.

10. Chuang M, Severson DL:Metabolic fate of exogenous diacylglycerols in

A10smooth muscle cells. Biochim Biophys Acta Lipids and Lipid Metab 1998, 1390:149–159.

11. Ko J, Small DM:Behavior of tetrahydrolipstatin in biological model

membranes and emulsions. J Lipid Res 1997, 38:1544–1552.

12. Olsen AM, Eisenberg BL, Kuemmerle NB, Flanagan AJ, Morganelli PM,

Lombardo PS, Swinnen JV, Kinlaw WB:Fatty acid synthesis is a therapeutic target in human liposarcoma. Int J Oncol 2010, 36:1309–1314.

13. Chuang H-Y, Chang Y-F, Hwang J-J:Antitumor effect of Orlistat, a fatty

acid synthase inhibitor, is via activation of caspase-3on human colorectal carcinoma-bearing animal. Biomed Pharmacother 2011, 65:286–292.

14. Kridel SJ, Axelrod F, Rozenkrantz N, Smith JW:Orlistat is a novel inhibitor

of fatty acid synthase with antitumor activity. Cancer Res 2004, 64:2070–2075.

15. Pallasch CP, Schwamb J, Koenigs S, Schulz A, Debey S, Kofler D, Schultze JL,

Hallek M, Ultsch A, Wendtner CM:Targeting lipid metabolism by the lipoprotein lipase inhibitor Orlistat results in apoptosis of B-cell chronic lymphocytic leukemia cells. Leukemia 2008, 22:585–592.

16. Schopfer FJ, Cole MP, Groeger AL, Chen CS, Khoo NKH, Woodcock SR,

Golin-Bisello F, Motanya UN, Li Y, Zhang JF, et al :Covalent Peroxisome Proliferator-activated Receptor gamma Adduction by Nitro-fatty Acids selective ligand activity and anti-diabetic signaling actions. J Biol Chem 2010, 285:12321–12333.

17. Itoh T, Fairall L, Amin K, Inaba Y, Szanto A, Balint BL, Nagy L, Yamamoto K,

Schwabe JWR:Structural basis for the activation of PPAR gamma by oxidized fatty acids. Nat Struct Mol Biol 2008, 15:924–931.

18. O'Neil DA, Porter EM, Elewaut D, Anderson GM, Eckmann L, Ganz T, Kagnoff

MF:Expression and regulation of the human beta-defensins hBD-1and hBD-2in intestinal epithelium. J Immunol 1999, 163:6718–6724.

19. Xu LH, Han C, Lim K, Wu T:Cross-talk between peroxisome proliferator-activated receptor delta and cytosolic phospholipase A2alpha/cyclooxygenase-2/prostaglandinE-2signaling pathways in human hepatocellular carcinoma cells. Cancer Res 2006, 66:11859–11868.

20. Rogue A, Spire C, Brun M, Claude N, Guillouzo A:Gene Expression Changes

Induced by PPAR Gamma Agonists in Animal and Human Liver. Ppar Res 2010. doi:ArticleID 325183, 10.1155/2010/325183.

Page 8of 8

21. Poston WCS, Reeves RS, Haddock CK, Stormer S, Balasubramanyam A,

Satterwhite O, Taylor JE, Foreyt JP:Weight loss in obese Mexican Americans treated for 1-year with Orlistat and lifestyle modification. Int J Obes 2003, 27:1486–1493.

22. Torgerson JS, Hauptman J, Boldrin MN, Sjostrom L:XENical in the

Prevention of Diabetes in Obese Subjects (XENDOS)study:a randomized study of Orlistat as an adjunct to lifestyle changes for the prevention of type 2diabetes in obese patients. Diabetes Care 2004, 27:856–856.

23. Tan NS, Shaw NS, Vinckenbosch N, Liu P, Yasmin R, Desvergne B, Wahli W,

Noy N:Selective cooperation between fatty acid binding proteins and peroxisome proliferator-activated receptors in regulating transcription. Mol Cell Biol 2002, 22:5114–5127.

24. Borgstrom B:Mode of Action of Tetrahydrolipstatin -a Derivative of the

Naturally-Occurring Lipase Inhibitor Lipstatin. Biochim Biophys Acta 1988, 962:308–316.

25. Leesnitzer LM, Parks DJ, Bledsoe RK, Cobb JE, Collins JL, Consler TG, Davis

RG, Hull-Ryde EA, Lenhard JM, Patel L, et al :Functional consequences of cysteine modification in the ligand binding sites of peroxisome proliferator activated receptors by GW9662. Biochemistry 2002, 41:6640–6650.

26. Nilsson-Ehle P, Schotz MC:A stable, radioactive substrate emulsion for

assay of Iipoprotein Iipase. J Lipid Res 1976, 17:536.